DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_021788c
Line Availability available from NASC (N661782) and ABRC (SALK_021788c)
Confirmed for Hit At2g41160
Parent of DUPLO pair 1388
Parent of pair(s) none

Gene hit At2g41160

 
Sequence (A. th genome BLAST matches underlined) 
ATAACTGTAAAGCGTTTGTGATACTATTGTGAATAAAAGGGCGTATCAAAAATGCGGATT
AAGAATGCGCAAAAAGCATTTCTTGATAATTTAAATGATGGACCAAGGGA
GenBank Accession BZ288404 [GenBank]
Graphic View Graphic view of gene At2g41160
Predicted Position of Insertion Chr2:17157198 - go to primer design
BLAST e Value 8e-28
Hit Clone Code (BAC ID) T3K9
Hit Gene Code At2g41160 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ubiquitin-associated (UBA) protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37