DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_023188
Line Availability available from NASC (N523188) and ABRC (SALK_023188)
Confirmed for Hit At3g06140
Parent of DUPLO pair 12611
Parent of pair(s) none

Gene hit At3g06140

 
Sequence (A. th genome BLAST matches underlined) 
GCTTAGAACCATAATTGGGACGAAATAGGTAAATTAAGGCTTAGGGAACTATTAAAGGAA
AGATCTTTACTCATGAGAACAATCTGGAATCACTCTTCCCTATAGAAAAGGTTTAAACTT
TACATGATTTGCTTGATGGGTTTGTGAATAATGATTTCAAGGCTTGATCTACAATGTGTT
GTGTAAGCT
GenBank Accession BZ289785 [GenBank]
Graphic View Graphic view of gene At3g06140
Predicted Position of Insertion Chr3:1858214 - go to primer design
BLAST e Value 1e-103
Hit Clone Code (BAC ID) F28L1
Hit Gene Code At3g06140 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RING/U-box superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37