DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_027488c
Line Availability available from NASC (N685529) and ABRC (SALK_027488c)
Confirmed for Hit At1g76350
Parent of DUPLO pair 12823
Parent of pair(s) none

Gene hit At1g76350

 
Sequence (A. th genome BLAST matches underlined)
TATTTCGCAGGGAGTCTCAAAGATGCTGCCACGAGTATTGGTGGTAAGTAAAACATTGAC
ATTCTCATTCTTGGAATTTGAATT
GenBank Accession BZ663880 [GenBank]
Graphic View Graphic view of gene At1g76350
Predicted Position of Insertion Chr1:28641982 - go to primer design
BLAST e Value 1e-38
Hit Clone Code (BAC ID) F15M4
Hit Gene Code At1g76350 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Plant regulator RWP-RK family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37