DUPLOdb - Line and FST details
Line specific information
| Line ID | SALK_031043 |
| Line Availability | available from NASC (N531043) and ABRC (SALK_031043) |
| Confirmed for Hit | At4g16265 |
| Parent of DUPLO pair | 1564 |
| Parent of pair(s) | none |
Gene hit At4g16265
| Sequence (A. th genome BLAST matches underlined) | GAAAGGTTCAGTAATATCATTCTATATCCCAAGGAAGACA |
| GenBank Accession | ED578852 [GenBank] |
| Graphic View |
|
| Predicted Position of Insertion | Chr4:9203686 - go to primer design |
| BLAST e Value | 2e-10 |
| Hit Clone Code (BAC ID) | FCAALL |
| Hit Gene Code | At4g16265 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | RNA polymerases M/15 Kd subunit |
| Insertion Classification | CDSi |
| Confirmation Status | confirmed, show confirmation sequences |
| Primer and wt-amplicons | show primer details |
|
Last Updated on Thursday, 10 June 2021 13:37 |




gabi-kat.de 