DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_042400
Line Availability available from NASC (N542400) and ABRC (SALK_042400)
Confirmed for Hit At1g77330
Parent of DUPLO pair none
Parent of pair(s) 1949

Gene hit At1g77330

 
Sequence (A. th genome BLAST matches underlined) 
CGAGGCTCTTTAGGCGGGAACTAGCTGGTTTGCATAGACATCCATGAAACCCCCGAACAC
AAACTTTGGATACTTCTTCTCACTTCCTTCCTCTTCCGCCACCGCGGCTGGCCCTATCGC
CGCCTTGTACGACGGGATTGCTAGAAAGGGAAGCTGATAGGAACCTTCGGGTTTTCCATT
CCTCCCTACGCCAACACCCTATGGCACGCACTCTTGTACCTGCCAACCACATTTTGGGTA
AAACTTTATACTCAAAATTGTATATTTTG
GenBank Accession ED586807 [GenBank]
Graphic View Graphic view of gene At1g77330
Predicted Position of Insertion Chr1:29063240 - go to primer design
BLAST e Value 6e-74
Hit Clone Code (BAC ID) F2P24
Hit Gene Code At1g77330 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37