DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_043673
Line Availability available from NASC (N543673) and ABRC (SALK_043673)
Confirmed for Hit At1g73230
Parent of DUPLO pair 185
Parent of pair(s) none

Gene hit At1g73230

 
Sequence (A. th genome BLAST matches underlined) 
TTTTTAAGGATGATGTAGTCATTCAGTTCATTAACCCTAAAGGTAAAACATCAAATTTTA
TGGCTTTATAAATCTCAGGTTTCGTATAAAATTTATTGTATTAATGGTTGTTGTGTCTCT
GTTTTAATGTTGCTATCACAGTTCAAGCT
GenBank Accession BH750824 [GenBank]
Graphic View Graphic view of gene At1g73230
Predicted Position of Insertion Chr1:27541103 - go to primer design
BLAST e Value 1e-79
Hit Clone Code (BAC ID) T18K17
Hit Gene Code At1g73230 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Nascent polypeptide-associated complex NAC
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BH750824 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37