DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_049398
Line Availability available from NASC (N549398) and ABRC (SALK_049398)
Confirmed for Hit At3g10730
Parent of DUPLO pair 12154
Parent of pair(s) none

Gene hit At3g10730

 
Sequence (A. th genome BLAST matches underlined) 
CCTGAAGCGGTAGATGCAAGTGTGTGAAGAGCTTCCATGGTTGGAATTGAAGTCTAGCCT
GACAGTGTTGACAAGTCCTGAGTGAGCAGAGTCTGCAATGTCGAATGTCTGTGCATTGGA
CCTGTCTAAGTCGTAACTGAATT
GenBank Accession BH751114 [GenBank]
Graphic View Graphic view of gene At3g10730
Predicted Position of Insertion Chr3:3358601 - go to primer design
BLAST e Value 5e-76
Hit Clone Code (BAC ID) T7M13
Hit Gene Code At3g10730 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation SAD1/UNC-84 domain protein 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit ED588828 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37