DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_052372
Line Availability available from NASC (N552372) and ABRC (SALK_052372)
Confirmed for Hit At5g43010
Parent of DUPLO pair none
Parent of pair(s) 2287, 96288, 96293

Gene hit At5g43010

 
Sequence (A. th genome BLAST matches underlined) 
CACTGCTCACTTTCCCTGTCACTTAAACACAACACATTTAAAATTTAACCAAGGGTCCAA
TGAGCAAAAATCTCAAAAGATAAAAAAGAAGGGTATTAGGTCGAGGAAAAATGATTACAT
CTTTCATTATCCAGGGGTCGAAGCACTTCTCCAATAATCTGCCCAACACTTTGAAGAGAC
TTGAGATCATCCTCGGTTTTGTTGAATT
GenBank Accession BH847320 [GenBank]
Graphic View Graphic view of gene At5g43010
Predicted Position of Insertion Chr5:17250351 - go to primer design
BLAST e Value 1e-100
Hit Clone Code (BAC ID) MBD2
Hit Gene Code At5g43010 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation regulatory particle triple-A ATPase 4A
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37