DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_058455
Line Availability available from NASC (N558455) and ABRC (SALK_058455)
Confirmed for Hit At1g23050
Parent of DUPLO pair 241
Parent of pair(s) none

Gene hit At1g23050

 
Sequence (A. th genome BLAST matches underlined) 
ACATTCTGTTTATAACTTTCTAACTACGTAACTCTTGTGGGAGTTTTTTTGTGTGTTATG
TATGTAAGAGATATTGTAA
GenBank Accession BH910224 [GenBank]
Graphic View Graphic view of gene At1g23050
Predicted Position of Insertion Chr1:8169097 - go to primer design
BLAST e Value 2e-18
Hit Clone Code (BAC ID) F19G10
Hit Gene Code At1g23050 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation hydroxyproline-rich glycoprotein family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BH910224 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37