DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_065342
Line Availability available from NASC (N565342) and ABRC (SALK_065342)
Confirmed for Hit At5g27430
Parent of DUPLO pair none
Parent of pair(s) 1009

Gene hit At5g27430

 
Sequence (A. th genome BLAST matches underlined) 
CTAATGTAAAATCTTTATCTATTTCTACAATGTTCAAAGAAACAGATGCATCTAAACCCC
TATGGCCATCAAATTCAATGAACGCTAAGCT
GenBank Accession ED594973 [GenBank]
Graphic View Graphic view of gene At5g27430
Predicted Position of Insertion Chr5:9688308 - go to primer design
BLAST e Value 2e-40
Hit Clone Code (BAC ID) F21A20
Hit Gene Code At5g27430 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Signal peptidase subunit
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37