DUPLOdb - Line and FST details
Line specific information
| Line ID | SALK_066841c |
| Line Availability | available from NASC (N662797) and ABRC (SALK_066841c) |
| Confirmed for Hit | At4g34950 |
| Parent of DUPLO pair | 2532 |
| Parent of pair(s) | none |
Gene hit At4g34950
| Sequence (A. th genome BLAST matches underlined) | CGACACGAACAACACCCAAAAGTCAACGGTCAACATAG |
| GenBank Accession | ED595923 [GenBank] |
| Graphic View | 
|
| Predicted Position of Insertion | Chr4:16643610 - go to primer design |
| BLAST e Value | 4e-14 |
| Hit Clone Code (BAC ID) | F11I11 |
| Hit Gene Code | At4g34950 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | Major facilitator superfamily protein |
| Insertion Classification | CDSi |
| Confirmation Status | confirmed, show confirmation sequences |
| Primer and wt-amplicons | show primer details |
|
Last Updated on Thursday, 10 June 2021 13:37 |
gabi-kat.de 