DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_069091c
Line Availability available from NASC (N678637) and ABRC (SALK_069091c)
Confirmed for Hit At5g57360
Parent of DUPLO pair none
Parent of pair(s) 2279, 69483

Gene hit At5g57360

 
Sequence (A. th genome BLAST matches underlined) 
TTAGTGCTTGTGCTGTCGGGAACAGAGTTGTTCTGTTTGGAGGAGAAGGTGTGAATATGC
AGCCTATGAATGATACCTTTGTTTTAGATCTGAATT
GenBank Accession BH848975 [GenBank]
Graphic View Graphic view of gene At5g57360
Predicted Position of Insertion Chr5:23243313 - go to primer design
BLAST e Value 3e-48
Hit Clone Code (BAC ID) MJB24
Hit Gene Code At5g57360 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Galactose oxidase/kelch repeat superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37