DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_073421
Line Availability available from NASC (N573421) and ABRC (SALK_073421)
Confirmed for Hit At2g22450
Parent of DUPLO pair none
Parent of pair(s) 2210, 2744

Gene hit At2g22450

 
Sequence (A. th genome BLAST matches underlined) 
TATTGAAGATATTCGACGTGGCAAGGCTTGCAATAGTAGCATCGTGTCTGCTTACTGTCT
TATTAGAAGGGGAAGGTCTTAAGTGAGAAA
GenBank Accession BH851724 [GenBank]
Graphic View Graphic view of gene At2g22450
Predicted Position of Insertion Chr2:9531172 - go to primer design
BLAST e Value 2e-37
Hit Clone Code (BAC ID) F14M13
Hit Gene Code At2g22450 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation riboflavin biosynthesis protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BH851724 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37