DUPLOdb - Line and FST details
Line specific information
| Line ID | SALK_077211c |
| Line Availability | available from NASC (N663026) and ABRC (SALK_077211c) |
| Confirmed for Hit | At1g10760 |
| Parent of DUPLO pair | 113 |
| Parent of pair(s) | none |
Gene hit At1g10760
| Sequence (A. th genome BLAST matches underlined) | CTTTTCTAGATTCAACATTGCAGCAG |
| GenBank Accession | ED597212 [GenBank] |
| Graphic View | 
|
| Predicted Position of Insertion | Chr1:3586830 - go to primer design |
| BLAST e Value | 3e-07 |
| Hit Clone Code (BAC ID) | F20B24 |
| Hit Gene Code | At1g10760 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | Pyruvate phosphate dikinase, PEP/pyruvate binding domain-containing protein |
| Insertion Classification | CDSi |
| Confirmation Status | confirmed, show confirmation sequences |
| Primer and wt-amplicons | show primer details |
|
Last Updated on Thursday, 10 June 2021 13:37 |
gabi-kat.de 