DUPLOdb - Line and FST details
Line specific information
Line ID | SALK_080688c |
Line Availability | available from NASC (N675909) and ABRC (SALK_080688c) |
Confirmed for Hit | At4g38950 |
Parent of DUPLO pair | 2576 |
Parent of pair(s) | none |
Gene hit At4g38950
Sequence (A. th genome BLAST matches underlined) | TCTTTTCCTCTATTCTCCTGGAAACCTTGTCCCCACA |
GenBank Accession | BZ352484 [GenBank] |
Graphic View | ![]() |
Predicted Position of Insertion | Chr4:18154855 - go to primer design |
BLAST e Value | 2e-06 |
Hit Clone Code (BAC ID) | F19H22 |
Hit Gene Code | At4g38950 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | ATP binding microtubule motor family protein |
Insertion Classification | CDSi |
Confirmation Status | confirmed, show confirmation sequences |
Primer and wt-amplicons | show primer details |
Last Updated on Thursday, 10 June 2021 13:37 |