DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_102687
Line Availability available from NASC (N602687) and ABRC (SALK_102687)
Confirmed for Hit At3g11020
Parent of DUPLO pair 2600
Parent of pair(s) none

Gene hit At3g11020

 
Sequence (A. th genome BLAST matches underlined) 
TTGTGAATCTAATCCATTTAGTCAGATTTTAGATGTTAGAGAAGAGTCTTGTGGAACCAG
GCCGGACAGTTGCACGGTTGGACATCAAGATATGAATT
GenBank Accession BH903466 [GenBank]
Graphic View Graphic view of gene At3g11020
Predicted Position of Insertion Chr3:3456521 - go to primer design
BLAST e Value 2e-49
Hit Clone Code (BAC ID) F9F8
Hit Gene Code At3g11020 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation DRE/CRT-binding protein 2B
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BH903466 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37