DUPLOdb - Line and FST details
Line specific information
| Line ID | SALK_108151c |
| Line Availability | available from NASC (N663618) and ABRC (SALK_108151c) |
| Confirmed for Hit | At1g79400 |
| Parent of DUPLO pair | 2621 |
| Parent of pair(s) | none |
Gene hit At1g79400
| Sequence (A. th genome BLAST matches underlined) | AAGGACTTTGCTTACGAAAAGACTTCGCTTGAATCTC |
| GenBank Accession | BZ378465 [GenBank] |
| Graphic View | 
|
| Predicted Position of Insertion | Chr1:29866562 - go to primer design |
| BLAST e Value | 9e-09 |
| Hit Clone Code (BAC ID) | T8K14 |
| Hit Gene Code | At1g79400 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | cation/H exchanger 2 |
| Insertion Classification | CDSi |
| Confirmation Status | confirmed, show confirmation sequences |
| Primer and wt-amplicons | show primer details |
|
Last Updated on Thursday, 10 June 2021 13:37 |
gabi-kat.de 