DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_111141c
Line Availability available from NASC (N655835) and ABRC (SALK_111141c)
Confirmed for Hit At2g34830
Parent of DUPLO pair 2523
Parent of pair(s) none

Gene hit At2g34830

 
Sequence (A. th genome BLAST matches underlined) 
CAACTTCTCCACTGGATCGGATGTCCATGCCGGCTGGAGCCGGTATGCACACCACTTTCT
TTGCCTGGGGCTTCCTGCGAGATCCACCAGCATATTGAGAGTTTGAGACATCTATCTGTC
AGTATACGCTCTAACTGTTGCAATGCAACGCTGATTTTGAGGTCCATTTCAGCGTGGGAC
ATGA
GenBank Accession BZ763010 [GenBank]
Graphic View Graphic view of gene At2g34830
Predicted Position of Insertion Chr2:14695085 - go to primer design
BLAST e Value 2e-45
Hit Clone Code (BAC ID) F19I3
Hit Gene Code At2g34830 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation WRKY DNA-binding protein 35
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37