DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_118107c
Line Availability available from NASC (N663781) and ABRC (SALK_118107c)
Confirmed for Hit At5g53540
Parent of DUPLO pair 2266
Parent of pair(s) none

Gene hit At5g53540

 
Sequence (A. th genome BLAST matches underlined) 
CGCCTATGGATCTGATATTTACAGCCCTTCGAAAGCCCAATTTCTAATATTATAAGATTT
TGTGAATTGCAGCCCGGGCCGTCGACCAAACCGTGACGCCGCTAAAAAGTCTCTCGAGCA
CAAAAGAGAAATCGCCAAACGTTTGGGTCGTCCTCTTATTCAAACCAATCAATACGAGGT
AATTTTGATTCTATACAGTTCTCTAATTGATTGAATT
GenBank Accession BZ382289 [GenBank]
Graphic View Graphic view of gene At5g53540
Predicted Position of Insertion Chr5:21750982 - go to primer design
BLAST e Value 2e-67
Hit Clone Code (BAC ID) MNC6
Hit Gene Code At5g53540 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation P-loop containing nucleoside triphosphate hydrolases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37