DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_119456
Line Availability available from NASC (N619456) and ABRC (SALK_119456)
Confirmed for Hit At5g18100
Parent of DUPLO pair 2808
Parent of pair(s) none

Gene hit At5g18100

 
Sequence (A. th genome BLAST matches underlined) 
TGAAACTACAGTGATTGCTTTTGTGATATTACTCTTAAACTTCAACAACTCAATTTGCAT
ATTGTGACATTGGACCATATGGATATCCAAAGGCTAAAAGAAGTTTCTACCTTTCCCAAG
GTCATCAAGATCCGCATGCACAACAACCGCCCTCCCGAGTATGGAATACTGCCCACTAAG
CGGTATCTGTGAATT
GenBank Accession BZ352905 [GenBank]
Graphic View Graphic view of gene At5g18100
Predicted Position of Insertion Chr5:5988407 - go to primer design
BLAST e Value 1e-102
Hit Clone Code (BAC ID) MRG7
Hit Gene Code At5g18100 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation copper/zinc superoxide dismutase 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37