DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_122890c
Line Availability available from NASC (N653567) and ABRC (SALK_122890c)
Confirmed for Hit At3g21700
Parent of DUPLO pair 1192
Parent of pair(s) none

Gene hit At3g21700

 
Sequence (A. th genome BLAST matches underlined) 
ATGTTGTATGAAGCCTCGAAGAAGAATAGCGTCGCGTTTAAAGCCTTCGCATATGTGCTC
GCCGGGTACACAATTACTTTCCTTATGTAACATAAATTATATTGAATTTCGCTGTATTGA
TTTGTTACTAGAATT
GenBank Accession BZ291979 [GenBank]
Graphic View Graphic view of gene At3g21700
Predicted Position of Insertion Chr3:7646087 - go to primer design
BLAST e Value 1e-33
Hit Clone Code (BAC ID) MSD21
Hit Gene Code At3g21700 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ras-related small GTP-binding family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37