DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_128444
Line Availability available from NASC (N628444) and ABRC (SALK_128444)
Confirmed for Hit At4g30860
Parent of DUPLO pair none
Parent of pair(s) 1680

Gene hit At4g30860

 
Sequence (A. th genome BLAST matches underlined) 
TCTCACTTGTTGCCCTTCTTTTCTTCCGGCGGGTTCTGGCCCTGAATTAACCAAATCTAT
CAATTCCCCGGAAAATCTACCCGGAGAATGCAATGGGAAACATTTACCTATGATTCCACC
GGAGGAAGAGGTCAAGG
GenBank Accession BZ356225 [GenBank]
Graphic View Graphic view of gene At4g30860
Predicted Position of Insertion Chr4:15024587 - go to primer design
BLAST e Value 2e-60
Hit Clone Code (BAC ID) T10C21
Hit Gene Code At4g30860 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation SET domain group 4
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BZ356225 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37