DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_129978c
Line Availability available from NASC (N672105) and ABRC (SALK_129978c)
Confirmed for Hit At2g40820
Parent of DUPLO pair none
Parent of pair(s) 921, 97547

Gene hit At2g40820

 
Sequence (A. th genome BLAST matches underlined) 
AACTGTCTTGACTCTCACCACTGCTAATATCCATATACATAGCAATAATTGGGAACGTGA
CGTGTCCAATGCGTGTACAGATGTGCTGACAGGTGCACATAGCTTCGGCTCGTGCCTAAG
AAACCGTGCCTTCTCACACAGNGGTATA
GenBank Accession BZ356935 [GenBank]
Graphic View Graphic view of gene At2g40820
Predicted Position of Insertion Chr2:17037952 - go to primer design
BLAST e Value 9e-07
Hit Clone Code (BAC ID) T20B5
Hit Gene Code At2g40820 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation stomatal closure actin-binding-like protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37