DUPLOdb - Line and FST details
Line specific information
| Line ID | SALK_134899 |
| Line Availability | available from NASC (N634899) and ABRC (SALK_134899) |
| Confirmed for Hit | At4g08430 |
| Parent of DUPLO pair | 2753 |
| Parent of pair(s) | none |
Gene hit At4g08430
| Sequence (A. th genome BLAST matches underlined) | TGTTGTTTTTCTAAACCCACAAGCT |
| GenBank Accession | BZ765856 [GenBank] |
| Graphic View | 
|
| Predicted Position of Insertion | Chr4:5349930 - go to primer design |
| BLAST e Value | 1e-06 |
| Hit Clone Code (BAC ID) | C18G5 |
| Hit Gene Code | At4g08430 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | Ulp1 protease family protein |
| Insertion Classification | CDSi |
| Confirmation Status | confirmed, show confirmation sequences |
| Primer and wt-amplicons | show primer details |
| Other FSTs Supporting this Hit | BZ765856 [GenBank] |
|
Last Updated on Thursday, 10 June 2021 13:37 |
gabi-kat.de 