DUPLOdb - Line and FST details
Line specific information
| Line ID | SALK_142729 |
| Line Availability | available from NASC (N642729) and ABRC (SALK_142729) |
| Confirmed for Hit | At4g14760 |
| Parent of DUPLO pair | 2608 |
| Parent of pair(s) | 25 |
Gene hit At4g14760
| Sequence (A. th genome BLAST matches underlined) | AGGAGAGAAAAATTCTTCTGCTCTAGATCTTCTATAAGCT |
| GenBank Accession | BZ769796 [GenBank] |
| Graphic View | 
|
| Predicted Position of Insertion | Chr4:8478391 - go to primer design |
| BLAST e Value | 3e-15 |
| Hit Clone Code (BAC ID) | FCAALL |
| Hit Gene Code | At4g14760 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | kinase interacting (KIP1-like) family protein |
| Insertion Classification | CDSi |
| Confirmation Status | confirmed, show confirmation sequences |
| Primer and wt-amplicons | show primer details |
| Other FSTs Supporting this Hit | BZ769796 [GenBank] |
|
Last Updated on Thursday, 10 June 2021 13:37 |
gabi-kat.de 