DUPLOdb - Line and FST details


Line specific information

 
Line ID Salk_020809
Line Availability available from NASC (N520809) and ABRC (Salk_020809)
Confirmed for Hit At1g28090
Parent of DUPLO pair 2468
Parent of pair(s) none

Gene hit At1g28090

 
Sequence (A. th genome BLAST matches underlined) 
GATTTACAGTTACTGCTAAAAAATTGGTATGTGTGTGTTTGGTGAAGTATTAATTCATGT
TAATTCAATATATATGTTTTTATACATAAAATTAAAATTCGGTCATTTT
GenBank Accession BZ287436 [GenBank]
Graphic View Graphic view of gene At1g28090
Predicted Position of Insertion Chr1:9795631 - go to primer design
BLAST e Value 4e-51
Hit Clone Code (BAC ID) F13K9
Hit Gene Code At1g28090 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Polynucleotide adenylyltransferase family protein
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37