DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_001525c
Line Availability available from NASC (N661269) and ABRC (SALK_001525c)
Confirmed for Hit At1g21170
Parent of DUPLO pair 222
Parent of pair(s) none

Gene hit At1g21170

 
Sequence (A. th genome BLAST matches underlined)
GGACCATAATCACTAGTAATATTATGATACTCAGAAAATGAACCATAGATATGGAGTTCA
GAGACAATCAGAGAACTGGATATGCAATTGTCTACCACCAATTTCTGTTTTTTAACAGCG
ATGTTGCCTTATATGGCTGCTAATTTCTGCATATACATTTTCCAGGATGATTCTATCTTT
AAAAGGTGAAGCTGCTAGATCCGAACATATGTTTGCGCATATTGAAGAAATTCTGACATC
TGCGAGACTTGCCTTTTTGAACTGCTTTCTGGATTTTGCTGGTAAGCT
GenBank Accession BH746775 [GenBank]
Graphic View Graphic view of gene At1g21170
Predicted Position of Insertion Chr1:7417145 - go to primer design
BLAST e Value 1e-143
Hit Clone Code (BAC ID) F16F4
Hit Gene Code At1g21170 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Exocyst complex component SEC5
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BH746775 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37