DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_015460c
Line Availability available from NASC (N661602) and ABRC (SALK_015460c)
Confirmed for Hit At4g01990
Parent of DUPLO pair 2424
Parent of pair(s) none

Gene hit At4g01990

 
Sequence (A. th genome BLAST matches underlined)
GTAAGCTTCAGAACTGAGGGGACTCCATTTCGTCAAGGTTTTGCAGAATT
GenBank Accession ED575371 [GenBank]
Graphic View Graphic view of gene At4g01990
Predicted Position of Insertion Chr4:871394 - go to primer design
BLAST e Value 1e-18
Hit Clone Code (BAC ID) T7B11
Hit Gene Code At4g01990 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Tetratricopeptide repeat (TPR)-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37