DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_017433c
Line Availability available from NASC (N665400) and ABRC (SALK_017433c)
Confirmed for Hit At3g10540
Parent of DUPLO pair none
Parent of pair(s) 2327

Gene hit At3g10540

 
Sequence (A. th genome BLAST matches underlined) 
AACAAGGGAGCCATTGGATTGGGTATTACTGTGCAAATCTTGAAATGGGAAGGACTTGAG
ACTTGAACGTTGAGGTCGTTGGAGTTATCAGACCAGATAATATTCCCTTTTACTACAAGC
T
GenBank Accession ED576927 [GenBank]
Graphic View Graphic view of gene At3g10540
Predicted Position of Insertion Chr3:3292287 - go to primer design
BLAST e Value 5e-63
Hit Clone Code (BAC ID) F13M14
Hit Gene Code At3g10540 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation 3-phosphoinositide-dependent protein kinase
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37