DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_019023c
Line Availability available from NASC (N664464) and ABRC (SALK_019023c)
Confirmed for Hit At4g19710
Parent of DUPLO pair 6777
Parent of pair(s) none

Gene hit At4g19710

 
Sequence (A. th genome BLAST matches underlined) 
GGTTAAAATATGATCACATTGATCGAAAGGGAAAACGTTTGTTGTGAATAATCTTACTTC
CCCAGAGTTTTCAGCATCTAGCCTTTCTTTTGCTAGGTCTCCATCGTACTGTGGGAGTTT
CTCCATGAATT
GenBank Accession BH789311 [GenBank]
Graphic View Graphic view of gene At4g19710
Predicted Position of Insertion Chr4:10729260 - go to primer design
BLAST e Value 6e-69
Hit Clone Code (BAC ID) T16H5
Hit Gene Code At4g19710 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation aspartate kinase-homoserine dehydrogenase ii
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37