DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_020988c
Line Availability available from NASC (N657539) and ABRC (SALK_020988c)
Confirmed for Hit At1g76300
Parent of DUPLO pair 213
Parent of pair(s) none

Gene hit At1g76300

 
Sequence (A. th genome BLAST matches underlined)
CTTCACCGGAATCCCCAAACTCCGACTCATCTTCGTCGATTCACTAAACCCTAATTGAAC
CTTCCCTTTTCCTTTTTAGCAGCCAAAAAGCT
GenBank Accession BZ287610 [GenBank]
Graphic View Graphic view of gene At1g76300
Predicted Position of Insertion Chr1:28625986 - go to primer design
BLAST e Value 8e-46
Hit Clone Code (BAC ID) T23E18
Hit Gene Code At1g76300 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation snRNP core protein SMD3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37