DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_024253
Line Availability available from NASC (N524253) and ABRC (SALK_024253)
Confirmed for Hit At5g16540
Parent of DUPLO pair 2355
Parent of pair(s) none

Gene hit At5g16540

 
Sequence (A. th genome BLAST matches underlined)
GTCACTCCGAATTTGCAGGTCCCTGTCTTCAGATAAAACTGCACAGACACAACAACAAAA
ATAGAAGCT
GenBank Accession BZ660793 [GenBank]
Graphic View Graphic view of gene At5g16540
Predicted Position of Insertion Chr5:5404067 - go to primer design
BLAST e Value 3e-32
Hit Clone Code (BAC ID) MQK4
Hit Gene Code At5g16540 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation zinc finger nuclease 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37