DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_024488c
Line Availability available from NASC (N656281) and ABRC (SALK_024488c)
Confirmed for Hit At5g01650
Parent of DUPLO pair 12305
Parent of pair(s) none

Gene hit At5g01650

 
Sequence (A. th genome BLAST matches underlined)
GGGGTGCTTCTTTTTTATTGTACCACGATTTCTAGGCCATTCCTGGCCCTTGAATT
GenBank Accession BZ661026 [GenBank]
Graphic View Graphic view of gene At5g01650
Predicted Position of Insertion Chr5:243651 - go to primer design
BLAST e Value 8e-20
Hit Clone Code (BAC ID) F7A7
Hit Gene Code At5g01650 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Tautomerase/MIF superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37