DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_027235c
Line Availability available from NASC (N668005) and ABRC (SALK_027235c)
Confirmed for Hit At2g43490
Parent of DUPLO pair 11669
Parent of pair(s) none

Gene hit At2g43490

 
Sequence (A. th genome BLAST matches underlined)
GCATTGCTTGAGCAAATCATTGTATCGCTTCCTGCGTGAAAATTCCAATAACGCTTGTAA
GCT
GenBank Accession BZ663632 [GenBank]
Graphic View Graphic view of gene At2g43490
Predicted Position of Insertion Chr2:18057520 - go to primer design
BLAST e Value 1e-28
Hit Clone Code (BAC ID) T1O24
Hit Gene Code At2g43490 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ypt/Rab-GAP domain of gyp1p superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37