DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_035250c
Line Availability available from NASC (N685627) and ABRC (SALK_035250c)
Parent of DUPLO pair 11954
Parent of pair(s) none

Gene hit At1g72690

 
Sequence (A. th genome BLAST matches underlined)
TGGCGTGTTTCTATTGTTTCTTTAGAGAAATTTCCGATCAAAACCATCCATTAA
GenBank Accession BH906684 [GenBank]
Graphic View Graphic view of gene At1g72690
Predicted Position of Insertion Chr1:27361415 - go to primer design
BLAST e Value 2e-23
Hit Clone Code (BAC ID) F28P22
Hit Gene Code At1g72690 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation neurofilament heavy protein
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on Thursday, 10 June 2021 13:37