DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_037121c
Line Availability available from NASC (N674492) and ABRC (SALK_037121c)
Confirmed for Hit At2g40830
Parent of DUPLO pair 2475
Parent of pair(s) none

Gene hit At2g40830

 
Sequence (A. th genome BLAST matches underlined)
TTGGCGACAGACCGGGCAAGAGTTGTGCTGAACCAGCCACGGGACAATGCAGTCAGAATG
ATAGATGTGGTTACACGGCATCTGTTTCGCTTCTGATCCCAGTTCGAATT
GenBank Accession BH750173 [GenBank]
Graphic View Graphic view of gene At2g40830
Predicted Position of Insertion Chr2:17044337 - go to primer design
BLAST e Value 2e-56
Hit Clone Code (BAC ID) T20B5
Hit Gene Code At2g40830 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RING-H2 finger C1A
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37