DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_040252c
Line Availability available from NASC (N656401) and ABRC (SALK_040252c)
Confirmed for Hit At1g63440
Parent of DUPLO pair 12600
Parent of pair(s) none

Gene hit At1g63440

 
Sequence (A. th genome BLAST matches underlined)
CCCAAATCAAGTCTTCTCAGAAACAATTCAACCGAGATTCGAGAGAATATCATAGCTTAC
ATCGACAGAGTTAGGGTAAAACAGAATCTGAGCACGATTATTCAGAGCATCGATGACAGC
ATCGTGAATT
GenBank Accession ED585730 [GenBank]
Graphic View Graphic view of gene At1g63440
Predicted Position of Insertion Chr1:23528017 - go to primer design
BLAST e Value 3e-68
Hit Clone Code (BAC ID) F2K11
Hit Gene Code At1g63440 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation heavy metal atpase 5
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit ED585730 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37