DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_040788
Line Availability available from NASC (N540788) and ABRC (SALK_040788)
Confirmed for Hit At3g11240
Parent of DUPLO pair 1802
Parent of pair(s) none

Gene hit At3g11240

 
Sequence (A. th genome BLAST matches underlined) 
TTATTCATTGCACTTAACAACTTCTCAGAAACAGCCTCTGGTGATAATCTGTTTTCTTCT
ACGTTTTTGGCTTTCTCCAATGTCTGTGTGTGGTTCATAGCAGCTACTATTGGAAAAAGC
AATGTTGCTGGGGTATAAGAAGTCTTCTGAACCTTCAGCTAGTTTCTTCC
GenBank Accession ED586139 [GenBank]
Graphic View Graphic view of gene At3g11240
Predicted Position of Insertion Chr3:3519891 - go to primer design
BLAST e Value 2e-75
Hit Clone Code (BAC ID) F11B9
Hit Gene Code At3g11240 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation arginine-tRNA protein transferase 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit ED586139 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37