DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_044963c
Line Availability available from NASC (N662300) and ABRC (SALK_044963c)
Confirmed for Hit At1g74910
Parent of DUPLO pair 2543
Parent of pair(s) none

Gene hit At1g74910

 
Sequence (A. th genome BLAST matches underlined)
GTTAATTCGATCACTGACCTGTGTTTCCAAAATAAAACATAAGAATCAAAGCT
GenBank Accession ED587705 [GenBank]
Graphic View Graphic view of gene At1g74910
Predicted Position of Insertion Chr1:28137141 - go to primer design
BLAST e Value 7e-23
Hit Clone Code (BAC ID) F25A4
Hit Gene Code At1g74910 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ADP-glucose pyrophosphorylase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37