DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_052789c
Line Availability available from NASC (N668265) and ABRC (SALK_052789c)
Confirmed for Hit At2g45760
Parent of DUPLO pair 1430
Parent of pair(s) none

Gene hit At2g45760

 
Sequence (A. th genome BLAST matches underlined)
ATTCTCACAACTGCGCATGTTCTCTTCTTCCATGGATTTCCATCTACCTTGAGTCCTTCC
GCTGAGATTACCTCAATCTCCAGTGATCTTTTG
GenBank Accession BH756077 [GenBank]
Graphic View Graphic view of gene At2g45760
Predicted Position of Insertion Chr2:18847639 - go to primer design
BLAST e Value 3e-27
Hit Clone Code (BAC ID) F4I18
Hit Gene Code At2g45760 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation BON association protein 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37