DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_054291
Line Availability available from NASC (N554291) and ABRC (SALK_054291)
Confirmed for Hit At1g78920
Parent of DUPLO pair 2436
Parent of pair(s) none

Gene hit At1g78920

 
Sequence (A. th genome BLAST matches underlined) 
TGTAAGATTTATTGATTGAATTTTCTGTTTCTCTTACAGTACCTCTTCTTCTTGTCGGAT
ATGGTTTTGGTGCTTCGTTTGTTGCCTTATTTGCTCAGTTGGGTGGTGGAATATATACTA
AGGGAGCTGATGTTG
GenBank Accession BH756837 [GenBank]
Graphic View Graphic view of gene At1g78920
Predicted Position of Insertion Chr1:29673802 - go to primer design
BLAST e Value 3e-71
Hit Clone Code (BAC ID) F9K20
Hit Gene Code At1g78920 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation vacuolar H -pyrophosphatase 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37