DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_055490c
Line Availability available from NASC (N675202) and ABRC (SALK_055490c)
Confirmed for Hit At3g18440
Parent of DUPLO pair none
Parent of pair(s) 525, 94440, 94442, 94443

Gene hit At3g18440

 
Sequence (A. th genome BLAST matches underlined)
ATGACGAATACCAGAGACTCTTCTTGGCTGGTTGACTCAACAGCTGATCTATAACCCTTG
TCATCAGGATCCTCTGAAGCT
GenBank Accession BH757127 [GenBank]
Graphic View Graphic view of gene At3g18440
Predicted Position of Insertion Chr3:6329606 - go to primer design
BLAST e Value 4e-32
Hit Clone Code (BAC ID) MYF24
Hit Gene Code At3g18440 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation aluminum-activated malate transporter 9
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37