DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_055969c
Line Availability available from NASC (N658250) and ABRC (SALK_055969c)
Confirmed for Hit At5g48680
Parent of DUPLO pair 11909
Parent of pair(s) none

Gene hit At5g48680

 
Sequence (A. th genome BLAST matches underlined)
GTTTTCATCTTTTTGCAGGTTGATATGGATGCTCTTAGGCATATGACAGATGATGACCTC
AAAGCTGTGCTCATACCCATGGTACAGTCCTTGATAA
GenBank Accession BH757295 [GenBank]
Graphic View Graphic view of gene At5g48680
Predicted Position of Insertion Chr5:19745030 - go to primer design
BLAST e Value 1e-41
Hit Clone Code (BAC ID) K15N18
Hit Gene Code At5g48680 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Sterile alpha motif (SAM) domain-containing protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37