DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_057421c
Line Availability available from NASC (N654206) and ABRC (SALK_057421c)
Confirmed for Hit At5g05760
Parent of DUPLO pair 1218
Parent of pair(s) none

Gene hit At5g05760

 
Sequence (A. th genome BLAST matches underlined) 
TGCTGGTATCATCTTGTTCCTGATTGCTTTCCTCTTCTTTGTGGCTTAAAACAATACCAT
TTTATCTCTTGTTCCTGGGGGTATCAAATCTATACATATGTTAAGCT
GenBank Accession ED590222 [GenBank]
Graphic View Graphic view of gene At5g05760
Predicted Position of Insertion Chr5:1729159 - go to primer design
BLAST e Value 6e-50
Hit Clone Code (BAC ID) MJJ3
Hit Gene Code At5g05760 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation syntaxin of plants 31
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BH790609 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37