DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_059288
Line Availability available from NASC (N559288) and ABRC (SALK_059288)
Confirmed for Hit At5g39760
Parent of DUPLO pair 11968
Parent of pair(s) none

Gene hit At5g39760

 
Sequence (A. th genome BLAST matches underlined)
ATCGTCTTCGTCACGTTTTTGCATCTTCCAACCAACACGTTCGGCGAATT
GenBank Accession BH791260 [GenBank]
Graphic View Graphic view of gene At5g39760
Predicted Position of Insertion Chr5:15912241 - go to primer design
BLAST e Value 4e-21
Hit Clone Code (BAC ID) MKM21
Hit Gene Code At5g39760 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation homeobox protein 23
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37