DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_066347c
Line Availability available from NASC (N675606) and ABRC (SALK_066347c)
Confirmed for Hit At5g64560
Parent of DUPLO pair none
Parent of pair(s) 2603, 96020

Gene hit At5g64560

 
Sequence (A. th genome BLAST matches underlined)
TAAACATAAGTTAATCTTGAGAGAGATCTTTATTTCATCCTCATGCGAATAGAATT
GenBank Accession ED595638 [GenBank]
Graphic View Graphic view of gene At5g64560
Predicted Position of Insertion Chr5:25807134 - go to primer design
BLAST e Value 1e-24
Hit Clone Code (BAC ID) MUB3
Hit Gene Code At5g64560 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation magnesium transporter 9
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37