DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_073673
Line Availability available from NASC (N573673) and ABRC (SALK_073673)
Confirmed for Hit At5g64080
Parent of DUPLO pair 8028
Parent of pair(s) none

Gene hit At5g64080

 
Sequence (A. th genome BLAST matches underlined)
GTTTAAGAGCAGTGCTTCTCTTGGAGTTACTTTGAATATCACTAAGGCTTCTACTCTTCC
CGCCGCATGCAAGCT
GenBank Accession BH851893 [GenBank]
Graphic View Graphic view of gene At5g64080
Predicted Position of Insertion Chr5:25646375 - go to primer design
BLAST e Value 9e-36
Hit Clone Code (BAC ID) MHJ24
Hit Gene Code At5g64080 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37