DUPLOdb - Line and FST details
Line specific information
| Line ID | SALK_075550 |
| Line Availability | available from NASC (N575550) and ABRC (SALK_075550) |
| Confirmed for Hit | At5g60360 |
| Parent of DUPLO pair | 2588 |
| Parent of pair(s) | none |
Gene hit At5g60360
| Sequence (A. th genome BLAST matches underlined) | ATTTGACATGGCAAGAGTTTCAAAGGACCAAGCT |
| GenBank Accession | BH852748 [GenBank] |
| Graphic View | 
|
| Predicted Position of Insertion | Chr5:24280871 - go to primer design |
| BLAST e Value | 8e-12 |
| Hit Clone Code (BAC ID) | K9B18 |
| Hit Gene Code | At5g60360 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | aleurain-like protease |
| Insertion Classification | CDSi |
| Confirmation Status | confirmed, show confirmation sequences |
| Primer and wt-amplicons | show primer details |
|
Last Updated on Thursday, 10 June 2021 13:37 |
gabi-kat.de 