DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_081725c
Line Availability available from NASC (N660494) and ABRC (SALK_081725c)
Confirmed for Hit At5g45180
Parent of DUPLO pair 202
Parent of pair(s) none

Gene hit At5g45180

 
Sequence (A. th genome BLAST matches underlined)
ACAAACATAGCGTGCCACAGTTTCCAAATTCATCGAATCATATGTTTTGTGGAAGCT
GenBank Accession ED597527 [GenBank]
Graphic View Graphic view of gene At5g45180
Predicted Position of Insertion Chr5:18275239 - go to primer design
BLAST e Value 3e-25
Hit Clone Code (BAC ID) K18C1
Hit Gene Code At5g45180 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Flavin-binding monooxygenase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37