DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_090247c
Line Availability available from NASC (N666701) and ABRC (SALK_090247c)
Confirmed for Hit At1g55740
Parent of DUPLO pair none
Parent of pair(s) 1398, 33546

Gene hit At1g55740

 
Sequence (A. th genome BLAST matches underlined) 
TTTCCTCCTAACGACAAATTTAGTCCCCTCGTCATCGAATCTTAAACTCACAATGGCTCC
TCCAGAATTAAACATCTCCATAAGCCCCACCGGTGCAAATTTACTTCCATCGGAAAATTC
CTTCACCGGAACCACCGTGAAAACTTCGTATTCACGTGGCATCAATGTCACTGGTAAAGA
TG
GenBank Accession ED598686 [GenBank]
Graphic View Graphic view of gene At1g55740
Predicted Position of Insertion Chr1:20835678 - go to primer design
BLAST e Value 2e-94
Hit Clone Code (BAC ID) F20N2
Hit Gene Code At1g55740 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation seed imbibition 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37